Guide RNA

Jump to: navigation, search

Guide RNA is the RNA that guides the insertion of uridines into mRNAs in trypanosomes in a process known as RNA editing. These are encoded at distant regions of the kinetoplast genome. The 5' end of a gRNA hybridizes to a short region of an unedited pre-mRNA, called an anchor sequence, while its 3' end functions as a template for the editing process. Many gRNAs do not hybridize to anchor sequences in the primary transcript, but rather to sequences in partially edited intermediates. Thus editing of a trypanosome pre-mRNA generally starts near the 3' end and progresses towards the 5' end in a repetitive process that requires several different gRNAs, which bind sequentially to anchor sequences in previously edited sections.(molecular cell biology lodish et al. 2004)

It is not clear why trypanosome kinetoplasts utilize such an elaborate mechanism to produce mRNAs. The finding that RNA editing is most extensive in the earliest trypanosomes to have evolved suggests that this process may be a "molecular fossil" of the mechanism of RNA synthesis during an early stage in the evolution of modern cells.[citation needed]

Overview of gRNA-mediated editing

The mitochondria for some trypanosome protozoa undergo gRNA-mediated mRNA editing. The gRNA identifies particular sequences and inserts or deletes Uridine (U) nucleotides. The edited portion of the mRNA is in the coding region, which has the effect of modifying the protein that is produced.

Example of gRNA-mediated editing

In the protozoan, Leishmania tarentolae, some mitochondrial genes are edited using this process. One such gene is Cyb.[1] While the exact sequence of events is still under study, one model has that the mRNA is actually edited twice in succession. For the first edit, the relevant sequence on the mRNA is

mRNA 5' AAAGAAAAGGCUUUAACUUCAGGUUGU 3'

The 3' end is used to anchor the gRNA (gCyb-I gRNA in this case) with normal basepairing (some G/U pairs are used). The 5' end does not exactly match and an endonuclease makes cuts in the mRNA to allow for alignment.

gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5'
mRNA 5'   A  A   AGAAA   A G  G C UUUAACUUCAGGUUGU 3'

The mRNA is now "repaired" by adding U, giving the sequence

gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5'
mRNA 5' UUAUUAUUUAGAAAUUUAUGUUGUCUUUUAACUUCAGGUUGU 3'

This particular gene has two overlapping gRNA editing sites. The 5' end of this section is the 3' anchor for another gRNA (gCyb-II gRNA).

Notes

  1. See [1] (Accessed 19 May 2006) for details.


v  d  e
Major families of biochemicals
Peptides | Amino acids | Nucleic acids | Carbohydrates | Nucleotide sugars | Lipids | Terpenes | Carotenoids | Tetrapyrroles | Enzyme cofactors | Steroids | Flavonoids | Alkaloids | Polyketides | Glycosides
Analogues of nucleic acids:Types of Nucleic AcidsAnalogues of nucleic acids:
Nucleobases: Purine (Adenine, Guanine) | Pyrimidine (Uracil, Thymine, Cytosine)
Nucleosides: Adenosine/Deoxyadenosine | Guanosine/Deoxyguanosine | Uridine | Thymidine | Cytidine/Deoxycytidine
Nucleotides: monophosphates (AMP, GMP, UMP, CMP) | diphosphates (ADP, GDP, UDP, CDP) | triphosphates (ATP, GTP, UTP, CTP) | cyclic (cAMP, cGMP, cADPR)
Deoxynucleotides: monophosphates (dAMP, dGMP, TMP, dCMP) | diphosphates (dADP, dGDP, TDP, dCDP) | triphosphates (dATP, dGTP, TTP, dCTP)
Ribonucleic acids: RNA | mRNA | tRNA | rRNA | gRNA | miRNA | ncRNA | piRNA | shRNA | siRNA | snRNA | snoRNA
Deoxyribonucleic acids: DNA | mtDNA | cDNA
Nucleic acid analogues: GNA | LNA | PNA | TNA | morpholino
Cloning vectors: plasmid | cosmid | fosmid | phagemid | BAC | YAC | HAC



Linked-in.jpg